Cloning and sequencing of 5'-flanking region of kappa-casein gene in yak

F. Boaliong,¹ L. Ning,² Zh. Xinbo³ and W. Changxin³

1. Hebei Handan Agricultural College, Handan 057150, Hebei, P.R. China
2. National Laboratory for Agro-biotechnology of China Agricultural University, Beijing 100094, P.R. China
3. College of Animal Science and Technology of China Agricultural University, Beijing 100094, P.R. China

Summary

Primers designed using sequence of kappa-casein gene in cattle (Bos taurus) are adopted to amplify the corresponding 5'-flanking sequence in yak (Bos grunniens). The amplified DNA fragment of 436 base pairs (bp) are cloned and sequenced. Comparisons of the sequences among cattle, sheep (Ovis aries), goat (Capra hircus) and human (Homo sapiens) identify a possible recognition site for transcription factor 'NF-AT^{h, m'} within the yak and cattle sequences (length 16 bp, position –329 to –334 nucleotides in yak), which does not exist in the sequences of sheep and goat. A 20 bp fragment (from the position –83 to –102 nucleotides in the yak sequence) is found in the sequences of yak, cattle, sheep and goat but it is not present in the corresponding region within the human sequence. The function of this fragment remains unknown.

Keywords: Gene, kappa-casein, regulation factor, yak

Introduction

Expression and regulation of casein genes is one of the most studied models in biochemical and genetic researches. It is well known that kappa-casein plays an essential role in the formation, stabilisation and aggregation of milk micelles, but several questions linked to the regulation and expression of this gene are still unanswered. Schild et al. (1994) reported 15 DNA variants located within the promoter region (+115/–1073) among 13 cows from seven breeds. But mutations associated with the difference of milk production characters among different breeds were not identified. Coll et al. (1995) reported the structural features of the 5'-flanking region of goat kappa-casein gene. All these previous studies show that recognition sequences of transcription factors present in other milk protein genes could be found in the promoter region of the kappa-casein gene. However, they are all in the distal region part of the promoters (> 400 bp). In the proximal promoter region only two transcription factor (AP2 and AP1) recognition sequences have been reported (Schild et al. 1994). Yak, cattle, sheep, goat and human have very distinguished milk-producing ability, so it is expected that comparison of the sequences among these species would help to understand their functions. This paper reports, for the first time, the 5'-flanking sequence of yak kappa-casein gene.

Materials and methods

Two primers, amplifying the fragment from –397 nt to +41 nt in the cattle kappa-casein gene including the partial sequences of intron 1 and the 5'-flanking region, were designed and used to amplify the corresponding region of 436 bp in yak  (F1:5'ATTACTTCATACTCAGGTTCTT3', F2: 5'GCTTGGCAGTAGGTTCAGTTGG 3') (Alexander et al. 1988).

PCR conditions: The PCR reaction mix was made of 2.5 ΅L buffer (500 mM KCl, 100 mM Tris.HCl, 15 mM MgCl₂, 0.01% gelatin), 2 ΅L dNTPs (2.5 mmoL/΅l), 0.5 ΅L of primers F1 and F2 each (50 pmoL/΅L), 1 U Taq DNA polymerase, 100 ng of template DNA extracted from muscle tissue samples, and then ddH₂O up to 25 ΅L. The temperature cycling was as follows: 5 min (95°C), then 30 cycles for 1 min (95°C), 1 min (61°C) and 2 min 30s (72°C), incubation at 72°C for 10 min, then storing at 4°C.

The PCR products were cloned into the PCRTM II T-vector and the recombinant plasmids transformed into the E. coli cL₁-Blue strain. DNA for sequencing was prepared by the alkaline lysis method (Sambrook et al. 1989). ABI PRISM^TM 377 DNA Sequencer was used for sequencing.

Results and discussion

Figure 1 shows the structure of the proximal 5'-flanking region of the yak kappa-casein gene where no recognition sequence of the mammary gland specific transcription factor is found. However, there are several recognition sequences of non-mammary specific transcription factors such as AP-2, TCF-1, CF1, NF-IL6, PEA3, GATA-3, OTF-2, ATF, which are all hormone responding factors (Faisst and Meyer 1992). So, it is supposed that the proximal region of the kappa-casein gene plays an essential role for the expression and regulation of the gene. In addition, the typical TAAT-box and CAAT-box are identified in position –25 nucleotide (nt) and –75 nt, respectively, with the former not present both in sheep and goat.

Figure 1. Structure of proximal 5’-flanking region of the yak kappa-casein gene.

This partial sequence of yak with its counterpart of cattle, goat, sheep and human are compared (Figure 2) and the results show that there is a 16 bp insertion in the cattle and yak sequences, from –329 nt to –334 nt, but not present in the sheep and goat sequences. Comparison of this fragment with the recognition sequences of other regulation factors shows 80% homology with the transcription factor NF-AT^{h, m.} Therefore, we assume that the fragment may contain a potential recognition site for NF-AT^{h, m}. It is known that the function of the NF-AT^{h, m} is regulated by the cyclosporin A and FK506 and that NF-AT^{h, m}  is involved in the immuno-suppressive response of cyclosporin A (Faisst and Meyer 1992). However, the function of this specific fragment remains unknown.

Note: ‘–’ indicate that the base is the same as in the reference sequence (yak). The ‘letters’ in lower case indicate the position and nature of a point mutation sequence between the other species and the yak. ‘.’ indicates the position of a deletion. 
Sources: Yak (this study, GenBank accession number AF194988); cattle (a) (Alexander et al. 1988, GeneBank accession number X14906); cattle (b) (Groenen et al. 1993, GeneBank accession number M75887); sheep (Spira et al. 1994, GeneBank accession number L31372); goat (Coll et al. 1995, GeneBank accession number Z33882); human (Edlund et al. 1996, GeneBank accession number U51899). 

Figure 2. Sequences comparisons of the proximal kappa-casein 5’-flanking region between yak, cattle, sheep, goat and human

There are 14 sites of mutations between Bovidae species (yak and cattle) and Caprinae species (goat and sheep) in the region sequenced (Figure 2). It is clear that some of these mutations play an essential role in the difference in milk production characters between the Bovidae and Caprinae, although not all of these mutations appear to affect the expression of the gene. For example, the –75 deletion leads to the loss of the CAAT box in sheep and goat sequences and the –226 deletion leads to the loss of a TCF–1 factor recognition site. In this case, these two mutations would influence the expression of the gene.

In this region of the gene, we also identify a long inserted fragment in yak (–65 to –374 nt) and a repeat sequence (–102 nt to –210 nt) related to the L1PA2 repeat sequence family in human. The function of this fragment is unknown.

Fragment from –83 nt to –102 nt in yak does not exist in the corresponding region of human sequence but it is present in cattle, sheep and goat. BLAST search in the GenBank database indicates that the fragment is present in the genome of a lot of species but at different locations. Possibly it may be a very important regulation factor recognition site. However, further analyses regarding its possible function in yak, cattle, sheep and goat are needed.

Acknowledgments

Chengji He and Xiolin Luo in Qinghai are acknowledged for supplying the muscle tissue samples.

References

Alexander L.J., Stewart A.F., Mackinlay A.G., Kapelinskaya T.V., Tkach T.M. and Gorodetsky S.I. 1988. Isolation and characterization of the bovine k-casein gene. European Journal of Biochemistry 178:395–401.

Coll A., Folch J.M. and Sanchez A. 1995. Structural features of the 5' flanking region of the caprine l-casein gene. Journal of Dairy Science 78:973–977.

Edlund A., Johansson T., Leidvik B. and Hansson L. 1996. Structure of the human k-casein gene. Gene 174:65–69.

Faisst S. and Meyer S. 1992. Compilation of vertebrate-encoded transcription factors. Nucleic Acids Research 20:3–26.

Sambrook J., Fritsch E.F. and Maniatis T. 1989. Molecular cloning: A laboratory manual (2nd edition). Cold Spring Harbor Laboratory Press, Cold Spring Harbor, USA. pp. 1.21–1.28.

Schild T.A., Wagner V. and Geldermann H. 1994. Variants within the 5'-flanking regions of bovine milk protein genes: I. k-casein-encoding gene. Theoretical and Applied Genetics 89:116–120.